Lab 12 make-up CRISPR

DescriptionUsing CRISPR to Identify the
Functions of Butterfly Genes
Activity
Student Handout
This document is made available by the Howard Hughes Medical Institute. Using this document, you agree to use this
document in accordance with the Terms of Use.
INTRODUCTION
Scientists have determined the complete DNA sequences of the genomes for many organisms, including
humans. By analyzing patterns in those sequences, they can estimate how many genes an organism has —
humans, for example, have about 20,000. But sequence patterns alone don’t specifically show what each gene
does. How can we figure this out?
In this activity, you will explore a tool that can be used to determine a gene’s function. You will then design your
own version of this tool to examine genes that affect the colors and patterns on butterfly wings.
PART 1: Using CRISPR-Cas9 to Inactivate Genes
One way to determine a gene’s function is to inactivate, or “knock out,” that gene and then observe the effect
on a cell or organism. Scientists can inactivate genes in cells growing in a lab or in model organisms, such as flies
or mice.
1. With a partner, discuss what it means to inactivate a gene and how it could be done. Record your ideas.
2. Can you think of additional ways to find out what genes do? Record one or two ideas.
CRISPR-Cas9, or CRISPR for short, is a biotechnology tool that can edit or inactivate specific genes. To learn more
about the CRISPR-Cas9 system, you can explore the “How It Works” section of the CRISPR-Cas9 Mechanism and
Applications Click & Learn.
As shown in the Click & Learn, the CRISPR-Cas9 tool uses a DNA-cutting enzyme, or nuclease, called Cas9. Cas9
was discovered in bacteria as a way for bacteria to fight off viruses. Scientists combine Cas9 with an RNA
molecule called a guide RNA to form a Cas9-RNA complex. Part of the guide RNA matches a target DNA
sequence within the gene that the scientists want to inactivate.
You will now go through each step in the process of using CRISPR-Cas9 to inactivate a gene, using a sequence
from an actual gene as an example.
Step 1: Targeting
First, the Cas9-RNA complex recognizes and binds to a three-nucleotide sequence called PAM, which stands for
“proto-spacer adjacent motif.” PAM sequences are abundant throughout the genome and can occur on either
strand of DNA. Every PAM sequence has the form 5′-NGG-3′, where the “N” can be any DNA nucleotide (A, C, G,
or T).
www.BioInteractive.org
Published February 2020
Page 1 of 7
Using CRISPR to Identify the Functions of Butterfly Genes
Activity
Student Handout
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight
six PAM sequences in the top (5’ to 3’) strand.
5′-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG3′
3′-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC5′
Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM,
the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will
keep binding to other PAM sequences until it finds the matching target DNA.
4. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to match a
specific target DNA sequence.
5′-GGCGGAGCGGUUCUUGGCAGGUUUUAGAGCUAGAAAUAGC-3′
Review the partial gene sequence reshown below. It contains a target DNA sequence that matches the guide
RNA above. Highlight the one PAM sequence in the top (5’ to 3’) strand that is next to this target DNA
sequence. (The sequence upstream, toward the 5’ end, of this PAM should match the underlined sequence
in the guide RNA, which makes the opposite DNA strand complementary to the underlined sequence.
Remember that U’s in RNA are equivalent to T’s in DNA.)
5′-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3′
3′-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC-5′
Step 2: Binding
Once Cas9 binds to the correct PAM, the guide RNA binds to the complement of the target DNA sequence.
5. Write down the guide RNA sequence that binds to the DNA, and the DNA sequence that it binds to (the
complement of the target DNA). Label the 5′ and 3′ ends for both the RNA and DNA strands.
Step 3: Cleaving
Once the guide RNA binds to the complement of the target DNA sequence, it activates the nuclease activity (DNAcutting ability) of the Cas9 enzyme. Cutting DNA is also called “cleaving.” Cas9 always cleaves both strands of
DNA. It cleaves both the target DNA and its complement three nucleotides upstream (toward the 5’ end) of the
PAM sequence.
6. Rewrite the target DNA sequence and its complement below, indicating where Cas9 would cut both strands
of DNA with a large space or vertical line (|).
Step 4: DNA Repair
www.BioInteractive.org
Published February 2020
Page 2 of 7
Using CRISPR to Identify the Functions of Butterfly Genes
Activity
Student Handout
After Cas9 cleaves the DNA, cellular enzymes will attempt to repair the break. Most of
the time, these enzymes repair the DNA without errors. However, Cas9 will keep cutting the DNA at the same
location until an error is made.
7. DNA repair errors include losing or inserting random nucleotides at the cut site. Explain how these changes
might inactivate a gene.
PART 2: Inactivating Genes in Butterflies
Robert Reed, a biologist at Cornell University, wanted to identify genes that are important in butterfly wing
patterns. He and his colleagues used CRISPR-Cas9 to inactivate different genes, then observed the effects on
butterflies. Models of three genes they inactivated are shown in Figure 1.
optix gene:
spalt gene:
Distal-less gene:
Figure 1. Models of three genes involved in butterfly wing patterns: optix, spalt, and Distal-less. The shaded rectangles
represent exons, and the horizontal lines between the rectangles represent introns. The black triangles above the
rectangles point to the target DNA sequences, which match the guide RNAs made by the scientists. The arrows at the start
of each gene represent the transcription start sites.
1. What are exons and introns, and how do they differ?
2. Figure 1 shows that the target DNA sequences are all in exons. Why might scientists want to target
sequences in exons, rather than introns, when inactivating genes?
PART 3: Designing a Guide RNA
You will now design your own guide RNA to inactivate a butterfly gene like Robert Reed did. Your goal is to
knock out the optix gene in a species of butterfly called the painted lady (Vanessa cardui).
www.BioInteractive.org
Published February 2020
Page 3 of 7
Using CRISPR to Identify the Functions of Butterfly Genes
Activity
Student Handout
Your guide RNA must match a target DNA sequence in the gene that you want to knock
out. A partial sequence of an exon from the butterfly’s optix gene is shown below.
5′-CGACACCGGTTCCAGCGCTCGAGCCACGCGAAGCTTCAGGCGCTGTGGCTGGAAG
3′-GCTGTGGCCAAGGTCGCGAGCTCGGTGCGCTTCGAAGTCCGCGACACCGACCTTC
CGCACTACCAGGAAGCGGAGCGCCTCCGCGGTCGCCCGCTCGGGCCCGTCGACAA
GCGTGATGGTCCTTCGCCTCGCGGAGGCGCCAGCGGGCGAGCCCGGGCAGCTGTT
GTACCGGGTGCGGAAGAAGTTCCCTCTGCCGAGGACTATTTGGGACGGCGAACAG-3′
CATGGCCCACGCCTTCTTCAAGGGAGACGGCTCCTGATAAACCCTGCCGCTTGTC-5′
1. Underline a 20-nucleotide target DNA sequence in the top (5’ to 3’) strand of the exon above. Remember
that this sequence should be directly upstream (on the 5’ end) of a PAM sequence (5’-NGG-3’).
2. Highlight the PAM sequence that is next to your target DNA sequence. This is where Cas9 will bind.
3. Rewrite the target DNA sequence and its complement below, indicating where Cas9 would cut both strands
of DNA with a large space or vertical line (|).
4. Record the 20-nucleotide guide RNA sequence that matches your target DNA sequence. This sequence
should not include the PAM.
5. Robert Reed’s lab at Cornell University designed guide RNAs to knock out the optix gene in three species of
butterflies: the painted lady (V. cardui), the common buckeye (Junonia coenia), and the Gulf fritillary
(Agraulis vanillae). Figures 2–4 compare the wings of the wild-type (control) butterflies to those of optix
knockouts (butterflies that had their optix gene inactivated).
www.BioInteractive.org
Published February 2020
Page 4 of 7
Activity
Student Handout
Using CRISPR to Identify the Functions of Butterfly Genes
Figure 2. V. cardui butterflies (left: wild-type control; right: optix knockout).
Figure 3. Wings of A. vanillae butterflies
(left: wild-type control; right: optix knockout).
Figure 4. Wings of J. coenia butterflies
(left: wild-type control; right: optix knockout).
a. For each species shown, describe how the wings of the optix knockout compare to those of the wildtype butterfly.
b. Based on the figures, predict the function of the optix gene. Does the gene have the same function in all
three butterfly species? If not, explain how it may differ among the species.
c. Justify your prediction with evidence from all three figures. Be specific.
6. Launch the CRISPR-Cas9: Mechanism & Applications Click & Learn and select “How It’s Used.” Scroll through
the videos on the right side of the screen and watch the three video interviews with Robert Reed. Revise
your answers to Question 6 based on information from the videos.
www.BioInteractive.org
Published February 2020
Page 5 of 7
Using CRISPR to Identify the Functions of Butterfly Genes
Activity
Student Handout
EXTENSION: Determine the Function of a Different Gene
Use what you’ve learned from the previous parts of this activity to explore knocking out a different gene: the
spalt gene in the V. cardui butterfly.
1. A partial sequence of an exon from the butterfly’s spalt gene is shown below. This time, only one of the DNA
strands is shown.
5’CGATATCTGGACCAATTTCAATAGCAACAGGACTACGTACTTTTCCTTCATATCCACTATTTCCAAA
TTCCCCACCAAGCAGTGTCTCATCTGGATGTCTTACACCTTTCCAAAGTAATCCCAACAGCATAATA
GACAGTGACATAACTCGTGATCCCATATTTTATAATTCACTTTTACCGCGTCCTGGAAGTAATGACA
ACTCTTGGGAAAGTTTGATTGAAATTACTAAAACTTCAGAAACGTCAAAATTGCAACAGTTAGTAG
ATAATATTGATAACAAAGTTACTGATCCTAACGAGTGTATTGTATGTCATCGCGTCTTATCTTGTA
AAAGTGCTTTACAGATGCACTACCGAACTCATACCGGGGAAAGACCTTTCAGATGTAAATTGTGCG
GTCGTGCTTTTACTACAAAGGGCAATTTAAAAACTCATATGGGTGTCCATCG-3’
a. Underline a 20-nucleotide target DNA sequence in the exon above. Remember that this sequence
should be directly upstream of a PAM sequence.
b. Highlight the PAM sequence that is next to your target DNA sequence.
c. Rewrite the target DNA sequence, indicating where Cas9 would cut the DNA with a large space or
vertical line (|).
2. Record the 20-nucleotide guide RNA sequence that matches your target DNA sequence.
3. The Reed lab used CRISPR-Cas9 to knock out the spalt gene in two species of butterflies: J. coenia and V.
cardui. Figures 5–6 compare the wings of the wild-type butterflies to those of spalt knockouts.
Figure 6. Closeups of markings on the wings of V. cardui
butterflies
(left: wild-type control; right: spalt knockout).
Figure 5. Wings of J. coenia butterflies (left:
wild-type control; right: spalt knockout).
www.BioInteractive.org
a.
For each species shown, describe how the wings of the
spalt knockout compare to those of the wild-type butterfly.
Published February 2020
Page 6 of 7
Using CRISPR to Identify the Functions of Butterfly Genes
Activity
Student Handout
b. Based on the figures, predict the function of the spalt gene. Does the gene have the same function in
both butterfly species? If not, explain how it may differ between the species.
c. Justify your prediction with evidence from both figures. Be specific.
www.BioInteractive.org
Published February 2020
Page 7 of 7

Purchase answer to see full
attachment

We offer the bestcustom writing paper services. We have done this question before, we can also do it for you.

Why Choose Us

  • 100% non-plagiarized Papers
  • 24/7 /365 Service Available
  • Affordable Prices
  • Any Paper, Urgency, and Subject
  • Will complete your papers in 6 hours
  • On-time Delivery
  • Money-back and Privacy guarantees
  • Unlimited Amendments upon request
  • Satisfaction guarantee

How it Works

  • Click on the “Place Order” tab at the top menu or “Order Now” icon at the bottom and a new page will appear with an order form to be filled.
  • Fill in your paper’s requirements in the "PAPER DETAILS" section.
  • Fill in your paper’s academic level, deadline, and the required number of pages from the drop-down menus.
  • Click “CREATE ACCOUNT & SIGN IN” to enter your registration details and get an account with us for record-keeping and then, click on “PROCEED TO CHECKOUT” at the bottom of the page.
  • From there, the payment sections will show, follow the guided payment process and your order will be available for our writing team to work on it.